Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXA1
Name homeobox A1
Class/Family ANTP/Hox1
Type protein-coding
Organism Chicken
Location 2
Synonyms
Link out Gene(374051)  RefSeq(XM_001234919)   
Comments chr2:32512832..32519213. HOXA2 annotated as NCBI, but it should be HOXA1 according its homeodomain.
 
Homeodomain
HD1: VRTNFTTKQL TELEKEFHFN KYLTRARRVE IAASLQLNET QVKIWFQNRR MKQKKRE
 
Noncoding Regulator(s)
gga-mir-181a Function Sequence: ACCAUCGACCGUUGAUUGUACC
Location: chromosome 8; 17
Target Position in 3'UTR of transcript : 15/820,
indicating as '#':

+--#-------------------------------------------------------------------------------+
target 5' C      CUCC     UCCGUCCCGU       GCCCG  G 3'
           GGUGCG    GUCGG          CGGUCGG     GG    
           CCAUGU    UAGUU          GCCAGCU     CC    
miRNA  3'                                  A      A 5'

mfe: -25.5 kcal/mol  p-value: 0.600524
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Lee SI. et al. 2011. Proc Natl Acad Sci U S A [PubMed:21670268]
miRBase:MI0001218
miRBase:MI0001243
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1