Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol MEOX2
Name mesenchyme homeobox 2
Class/Family ANTP/Meox
Type protein-coding
Organism Human
Location 7p22.1
Synonyms GAX;MOX2;
Link out HGNC(7014)  Gene(4223)  RefSeq(NM_005924)  OMIM(600535)  
Comments  
 
Homeodomain
HD1: PRKERTAFTK EQIRELEAEF AHHNYLTRLR RYEIAVNLDL TERQVKVWFQ NRRMKWKRVK
 
Noncoding Regulator(s)
hsa-mir-301a Function Sequence: CAGUGCAAUAGUAUUGUCAAAGC
Location: chromosome 17q22
Target Position in 3'UTR of transcript ENST00000262041: 410/1175,
indicating as '#':

+----------------------------#-----------------------------------------------------+
target 5' A  G       GUAUU    UUUGC        A 3'
           GU   GGCAG     UGCU     UUGCACUG    
           CG   CUGUU     AUGA     AACGUGAC    
miRNA  3'    AAA              U              5'

mfe: -22.3 kcal/mol  p-value: 0.622383
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Cao G, et al. 2010. Biochem Biophys Res Commun [PubMed:20470754]
HGNC:31622
miRBase:MI0000745
hsa-mir-130a Function Sequence: CAGUGCAAUGUUAAAAGGGCAU
Location: chromosome 11q12.1
Target Position in 3'UTR of transcript ENST00000262041: 270/1175,
indicating as '#':

+-------------------#--------------------------------------------------------------+
target 5' U                     A 3'
           UGCUUUU   GC UUGCACUG    
           ACGGGAA   UG AACGUGAC    
miRNA  3' U       AAU  U          5'

mfe: -24.0 kcal/mol  p-value: 0.613094
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Chen Y. et al. 2008. Blood [PubMed:17957028]
HGNC:31514
miRBase:MI0000448
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1