Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol PROX1
Name prospero homeobox 1
Class/Family PROS/Prox
Type protein-coding
Organism Human
Location 1q41
Synonyms
Link out HGNC(9459)  Gene(5629)  RefSeq(NM_002763)  OMIM(601546)  
Comments  
 
Homeodomain
HD1: GSAMQEGLSP NHLKKAKLMF FYTRYPSSNM LKTYFSDVKF NRCITSQLIK WFSNFREFYY  60
IQM
 
Noncoding Regulator(s)
hsa-mir-31 Function Sequence: AGGCAAGAUGCUGGCAUAGCU
Location: chromosome 9p21.3
Target Position in 3'UTR of transcript ENST00000541470: 186/583,
indicating as '#':

+--------------------------#-------------------------------------------------------+
target 5' U     UUUUCUUUC    UUUAGUUU          C 3'
           GGUUG         UGCC        GC UUUUGCC    
           UCGAU         ACGG        CG AGAACGG    
miRNA  3'                    U         U       A 5'

mfe: -21.6 kcal/mol  p-value: 0.616634
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Pedrioli DM, et al. 2010. Mol Cell Biol [PubMed:20479124]
HGNC:31630
miRBase:MI0000089
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1