Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol SATB2
Name SATB family member 2
Class/Family CUT/Satb
Type protein-coding
Organism Human
Location 2q33
Synonyms
Link out HGNC(21637)  Gene(23314)  RefSeq(NM_015265)  OMIM(608148)  
Comments  
 
Homeodomain
HD1: KPRSRTKISL EALGILQSFI HDVGLYPDQE AIHTLSAQLD LPKHTIIKFF QNQRYHVKHH  60
G
 
Noncoding Regulator(s)
hsa-mir-31 Function Sequence: AGGCAAGAUGCUGGCAUAGCU
Location: chromosome 9p21.3
Target Position in 3'UTR of transcript ENST00000417098: 2346/2711,
indicating as '#':

+----------------------------------------------------------------------#-----------+
target 5' A   GAAUC   G        A    G 3'
           AGU     UGU GGCAUUUU GCCU    
           UCG     ACG UCGUAGAA CGGA    
miRNA  3'     AU      G               5'

mfe: -25.8 kcal/mol  p-value: 0.613406
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Aprelikova O, et al. 2010. Cell Cycle [PubMed:20980827]
HGNC:31630
miRBase:MI0000089
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1