Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol SIX1
Name SIX homeobox 1
Class/Family SINE/Six1/2
Type protein-coding
Organism Human
Location 14q23.1
Synonyms
Link out HGNC(10887)  Gene(6495)  RefSeq(NM_005982)  OMIM(601205)  
Comments  
 
Homeodomain
HD1: GEETSYCFKE KSRGVLREWY AHNPYPSPRE KRELAEATGL TTTQVSNWFK NRRQRDRAAE
 
Noncoding Regulator(s)
hsa-mir-185 Function Sequence: UGGAGAGAAAGGCAGUUCCUGA
Location: chromosome 22q11.21
Target Position in 3'UTR of transcript ENST00000247182: 169/1586,
indicating as '#':

+---------#------------------------------------------------------------------------+
target 5' A   C  U  CAA    AAUCUCCUC         A 3'
           CAG GA CU   GCUU         UUCUCUCCA    
           GUC CU GA   CGGA         AAGAGAGGU    
miRNA  3' A      U                             5'

mfe: -25.3 kcal/mol  p-value: 0.610127
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Imam JS, et al. 2010. Oncogene [PubMed:20603620]
HGNC:31556
miRBase:MI0000482
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1