Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol ZEB2
Name zinc finger E-box binding homeobox 2
Class/Family ZF/Zeb
Type protein-coding
Organism Human
Location 2q22.3
Synonyms ZFHX1B;SIP1;SMADIP1;
Link out HGNC(14881)  Gene(9839)  RefSeq(NM_014795)  OMIM(605802)  
Comments  
 
Homeodomain
HD1: GMTSPINPYK DHMSVLKAYY AMNMEPNSDE LLKISIAVGL PQEFVKEWFE QRKVYQYSNS
 
Noncoding Regulator(s)
hsa-mir-138 Function Sequence: AGCUGGUGUUGUGAAUCAGGCCG
Location: chromosome 3p21.32; 16q13
Target Position in 3'UTR of transcript ENST00000303660: 745/1450,
indicating as '#':

+------------------------------------------#---------------------------------------+
target 5' G   AACA  GG    CUUU         U 3'
           GGU    UG  UUAC    GCACCAGCU    
           CCG    AC  AGUG    UGUGGUCGA    
miRNA  3' G   G     UA    U              5'

mfe: -30.3 kcal/mol  p-value: 0.584462
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Liu X. et al. 2011. Biochem J [PubMed:21770894]
HGNC:MIR138-1
HGNC:MIR138-2
miRBase:MI0000476
miRBase:MI0000455
hsa-mir-221 Function Sequence: AGCUACAUUGUCUGCUGGGUUUC
Location: chromosome Xp11.3
Target Position in 3'UTR of transcript ENST00000303660: 764/1450,
indicating as '#':

+-------------------------------------------#--------------------------------------+
target 5'   U  A     UU       UA    C 3'
             GC CCAGC   CAGUGU  AGCU    
             UG GGUCG   GUUACA  UCGA    
miRNA  3' CUU        UCU              5'

mfe: -25.8 kcal/mol  p-value: 0.607059
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Chen Y, et al. 2010. Mol Cell Biol [PubMed:20516212]
HGNC:31601
miRBase:MI0000298
hsa-mir-200b Function Sequence: UAAUACUGCCUGGUAAUGAUGA
Location: chromosome 1p36.33
Target Position in 3'UTR of transcript ENST00000303660: 766/1450,
indicating as '#':

+-------------------------------------------#--------------------------------------+
target 5'        C     CUU        A 3'
                  ACCAG   CAGUGUUA    
                  UGGUC   GUCAUAAU    
miRNA  3' AGUAGUAA     C            5'

mfe: -20.2 kcal/mol  p-value: 0.634861
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Gregory PA, et al. 2008. Nat Cell Biol [PubMed:18376396]
HGNC:31579
miRBase:MI0000342
hsa-mir-200a Function Sequence: UAACACUGUCUGGUAACGAUGU
Location: chromosome 1p36.33
Target Position in 3'UTR of transcript ENST00000303660: 749/1450,
indicating as '#':

+------------------------------------------#---------------------------------------+
target 5' A    G GUUACCUUUGC     CUU        A 3'
           ACAU G           ACCAG   CAGUGUUA    
           UGUA C           UGGUC   GUCACAAU    
miRNA  3'      G AA              U            5'

mfe: -23.4 kcal/mol  p-value: 0.618546
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Gregory PA, et al. 2008. Nat Cell Biol [PubMed:18376396]
HGNC:31578
miRBase:MI0000737
hsa-mir-205 Function Sequence: UCCUUCAUUCCACCGGAGUCUG
Location: chromosome 1q32.2
Target Position in 3'UTR of transcript ENST00000303660: 617/1450,
indicating as '#':

+-----------------------------------#----------------------------------------------+
target 5'  U        AC          A 3'
            GAC CUGG    GUGAAGGA    
            CUG GGCC    UACUUCCU    
miRNA  3' GU   A    ACCU          5'

mfe: -24.2 kcal/mol  p-value: 0.614596
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Gregory PA, et al. 2008. Nat Cell Biol [PubMed:18376396]
HGNC:31583
miRBase:MI0000285
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1