Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXB8
Name homeobox B8
Class/Family ANTP/Hox6-8
Type protein-coding
Organism Human
Location 17q21.32
Synonyms HOX2D
Link out HGNC(5119)  Gene(3218)  RefSeq(NM_024016)  OMIM(142963)  
Comments  
 
Homeodomain
HD1: RRRGRQTYSR YQTLELEKEF LFNPYLTRKR RIEVSHALGL TERQVKIWFQ NRRMKWKKEN
 
Noncoding Regulator(s)
hsa-mir-196a Function Sequence: UAGGUAGUUUCAUGUUGUUGGG
Location: chromosome 12q13.13; 17q21.32
Target Position in 3'UTR of transcript ENST00000239144: 410/855,
indicating as '#':

+---------------------------------------#------------------------------------------+
target 5' U                      U 3'
           CCCAACAACAUGAAACUGCCUA    
           GGGUUGUUGUACUUUGAUGGAU    
miRNA  3'                          5'

mfe: -41.7 kcal/mol  p-value: 0.516388
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Yekta S, et al. 2004. Science [PubMed:15105502]
HGNC:31568
HGNC:31567
miRBase:MI0000279
miRBase:MI0000238
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1