Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol HOXC8
Name homeobox C8
Class/Family ANTP/Hox6-8
Type protein-coding
Organism Human
Location 12q13.13
Synonyms HOX3A
Link out HGNC(5129)  Gene(3224)  RefSeq(NM_022658)  OMIM(142970)  
Comments  
 
Homeodomain
HD1: RRSGRQTYSR YQTLELEKEF LFNPYLTRKR RIEVSHALGL TERQVKIWFQ NRRMKWKKEN
 
Noncoding Regulator(s)
hsa-mir-196 Function Sequence: UAGGUAGUUUCAUGUUGUUGGG
Location: chromosome 12q13.13; 17q21.32; 7p15.2
Target Position in 3'UTR of transcript ENST00000040584: 1088/1382,
indicating as '#':

+---------------------------------------------------------------#------------------+
target 5' A                      G 3'
           CCCAACAAC UGAGACUGCCUA    
           GGGUUGUUG ACUUUGAUGGAU    
miRNA  3'           U              5'

mfe: -37.5 kcal/mol  p-value: 0.547034
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Yekta S, et al. 2004. Science [PubMed:15105502]
HGNC:31568
HGNC:31567
HGNC:31790
miRBase:MI0000279
miRBase:MI0000238
miRBase:MI0001150
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1