Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Hoxb8
Name
Class/Family ANTP/Hox6-8
Type protein-coding
Organism Mouse
Location 11 D; 11 56.01 cM
Synonyms Hox-2.4
Link out MGI(96189)  Gene(15416)  RefSeq(NM_010461)   
Comments  
 
Homeodomain
HD1: RRRGRQTYSR YQTLELEKEF LFNPYLTRKR RIEVSHALGL TERQVKIWFQ NRRMKWKKEN
 
Noncoding Regulator(s)
mmu-mir-196 Function Sequence: UAGGUAGUUUCAUGUUGUUGGG
Location: chromosome 11: 59.8cM; 15: 58.04cM; 6: 25.4cM
Target Position in 3'UTR of transcript ENSMUST00000052650: 417/855,
indicating as '#':

+----------------------------------------#-----------------------------------------+
target 5' U                      U 3'
           CCCAACAACAUGAAACUGCCUA    
           GGGUUGUUGUACUUUGAUGGAU    
miRNA  3'                          5'

mfe: -41.7 kcal/mol  p-value: 0.516388
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Yekta S. et al 2004. Science [PubMed:15105502]
MGI:2676860
MGI:3618739
MGI:3618741
miRBase:MI0000552
miRBase:MI0000553
miRBase:MI0001151
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1