Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Pax3
Name
Class/Family PRD/Pax3/7
Type protein-coding
Organism Mouse
Location 1 C4; 1 44.0 cM
Synonyms Sp; Pax-3; splotch
Link out MGI(97487)  Gene(18505)  RefSeq(NM_008781)   
Comments  
 
Homeodomain
HD1: QRRSRTTFTA EQLEELERAF ERTHYPDIYT REELAQRAKL TEARVQVWFS NRRARWRKQA
 
Noncoding Regulator(s)
mmu-mir-1 Function Sequence: UGGAAUGUAAAGAAGUAUGUAU
Location: chromosome 2: 102.92cM; 18: 5.4cM
Target Position in 3'UTR of transcript ENSMUST00000004994: 1258/1534,
indicating as '#':

+------------------------------------------------------------------#---------------+
target 5' G    UGUUAUU         C      U 3'
           GUGC       UAUUUCUUU UAUUCU    
           UAUG       AUGAAGAAA GUAAGG    
miRNA  3'      U               U      U 5'

mfe: -18.5 kcal/mol  p-value: 0.643980
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Hirai H, et al. 2010. J Cell Biol [PubMed:20956382]
MGI:2676869
MGI:3618746
miRBase:MI0000139
miRBase:MI0000652
mmu-mir-206 Function Sequence: UGGAAUGUAAGGAAGUGUGUGG
Location: chromosome 1
Target Position in 3'UTR of transcript ENSMUST00000004994: 995/1534,
indicating as '#':

+----------------------------------------------------#-----------------------------+
target 5' C      CCU   UGU     UU    A  3'
           UCACAU   GCU   UCCUU  GUUC     
           GGUGUG   UGA   AGGAA  UAAG     
miRNA  3'                      UG    GU 5'

mfe: -22.0 kcal/mol  p-value: 0.626341
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Hirai H, et al. 2010. J Cell Biol [PubMed:20956382]
MGI:2676881
miRBase:MI0000249
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1