Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Isl1
Name
Class/Family LIM/Isl
Type protein-coding
Organism Mouse
Location 13 D2.3
Synonyms
Link out MGI(101791)  Gene(16392)  RefSeq(NM_021459)   
Comments  
 
Homeodomain
HD1: TTRVRTVLNE KQLHTLRTWY AANPRPDALM KEQLVEMTGL SPRVIRVWFQ NKRCKDKKRS
 
Noncoding Regulator(s)
mmu-mir-17 Function Sequence: CAAAGUGCUUACAGUGCAGGUAG
Location: chromosome 14: 59.4cM
Target Position in 3'UTR of transcript ENSMUST00000036060: 462/1210,
indicating as '#':

+-------------------------------#--------------------------------------------------+
target 5' A      U  CAAACAGGA   CC      A    3'
           CUGCCU GC         GCU   GGCAC       
           GAUGGA CG         UGA   UCGUG       
miRNA  3'                       CAU     AAAC 5'

mfe: -21.2 kcal/mol  p-value: 0.628360
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Wang J, et al. 2010. Dev Cell [PubMed:21145505]
MGI:3619065
miRBase:MI0000687
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1