Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol Onecut2
Name
Class/Family CUT/Onecut
Type protein-coding
Organism Mouse
Location 18 E1
Synonyms Oc2; OC-2; MGC124203; C730009D12
Link out MGI(1891408)  Gene(225631)  RefSeq(NM_194268)   
Comments  
 
Homeodomain
HD1: QKKSRLVFTD LQRRTLFAIF KENKRPSKEM QITISQQLGL ELTTVSNFFM NARRRSLEKW
 
Noncoding Regulator(s)
mmu-mir-218 Function Sequence: UUGUGCUUGAUCUAACCAUGU
Location: chromosome 5: 26.17cM; 11: 21.71cM
Target Position in 3'UTR of transcript ENSMUST00000115145: 937/14356,
indicating as '#':

+------#---------------------------------------------------------------------------+
target 5' A      CU            U 3'
           AUAUGG     UCAAGCACA    
           UGUACC     AGUUCGUGU    
miRNA  3'        AAUCU         U 5'

mfe: -24.2 kcal/mol  p-value: 0.636423
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Simion A, et al. 2010. Biochem Biophys Res Commun [PubMed:19913497]
MGI:3618751
MGI:3618752
miRBase:MI0000700
miRBase:MI0000701
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1