Home | Human | Mouse | Chicken | Frog | Zebrafish | Amphioxus | Fruitfly | Beetle | Honeybee | Nematode
Total | HomeoReg | Summary | Download | Compare | BLAST | Search (gene symbol, e.g. HOX)

Locus Information
Basic Information  
Symbol cog-1
Name Connection Of Gonad defective
Class/Family ANTP/Nk6
Type protein-coding
Organism Nematode
Location II:23.70 +/- 0.059 cM
Synonyms R03C1.3
Link out WormBase(WBGene00000584)  Gene(175149)  RefSeq(NM_001027093)   
Comments  
 
Homeodomain
HD1: KKQSRPTFTG HQIYQLERKF EQTKYLAGAD RAQLAQELNM SESQVKVWFQ NRRTKWRKKE
 
Noncoding Regulator(s)
cel-lsy-6 Function Sequence: UUUUGUAUGAGACGCAUUUCG
Location: chromosome V: 10647207-10647279 [+]
Target Position in 3'UTR of transcript R03C1.3a: 267/394,
indicating as '#':

+-------------------------------------------------------#--------------------------+
target 5'      C  CA           A 3'
                GU  CUUAUACAAAA    
                CG  GAGUAUGUUUU    
miRNA  3' GCUUUA  CA             5'

mfe: -17.6 kcal/mol  p-value: 0.634694
(mfe: minimum free energy. Only the most minimal one demonstrated here.)
Reference: Johnston RJ. et al. 2003. Nature [PubMed:14685240]
miRBase:MI0000801
Acknowledgement: Sequences Hybrid modified from result of RNAhybrid v2.1